Конструирование векторной вакцины на основе холодо-адаптированного вируса гриппа для защиты от бактериальной инфекции, вызываемой стрептококками группы В

Авторы:
  • Т. А. Смолоногина
    ФГБНУ «Институт экспериментальной медицины» ФАНО, Санкт-Петербург, Россия 197376
  • И. Н. Исакова-Сивак
    ФГБНУ «Институт экспериментальной медицины» ФАНО, Санкт-Петербург, Россия 197376
  • Т. С. Котомина
    ФГБНУ «Институт экспериментальной медицины» ФАНО, Санкт-Петербург, Россия 197376
  • А. С. Евсина
    ФГБНУ «Институт экспериментальной медицины» ФАНО, Санкт-Петербург, Россия 197376
  • Е. А. Степанова
    ФГБНУ «Институт экспериментальной медицины» ФАНО, Санкт-Петербург, Россия 197376
  • П. И. Прокопенко
    ФГБНУ «Институт экспериментальной медицины» ФАНО, Санкт-Петербург, Россия 197376
  • Г. Ф. Леонтьева
    ФГБНУ «Институт экспериментальной медицины» ФАНО, Санкт-Петербург, Россия 197376
  • А. Н. Суворов
    ФГБНУ «Институт экспериментальной медицины» ФАНО, Санкт-Петербург, Россия 197376
  • Л. Г. Руденко
    ФГБНУ «Институт экспериментальной медицины» ФАНО, Санкт-Петербург, Россия 197376
Журнал: Молекулярная генетика, микробиология и вирусология. 2019;37(1): 25-34
Просмотрено: 959 Скачано: 56

Введение

Иммунизация классическими инактивированными и живыми аттенуированными вакцинами привела за последние десятилетия к существенному снижению заболеваемости и успешному контролю за многими инфекционными заболеваниями человека. Однако остается достаточно большое число бактериальных патогенов, для которых иммунизация при помощи традиционных подходов является нецелесообразной, чаще всего в силу недостаточной безопасности таких вакцин, а также из-за узкой специфичности вырабатываемого иммунитета и высокой степени вариабельности антигенных свойств патогена, позволяющей ему легко уходить от иммунного барьера организма-хозяина. Например, наиболее хорошо изученные вакцинные кандидаты против стрептококков группы, А (СГА) базируются на свойствах основного фактора патогенности стрептококков — М-белка, однако он является высоковариабельным в клинических штаммах, что с большой вероятностью может привести к появлению новых антигенных вариантов [1].

Стрептококки группы В (СГВ), Streptococcus agalactiae — одни из наиболее распространенных бактериальных патогенов, вызывающие заболевания среди трех групп населения: новорожденные, беременные женщины и взрослые из группы риска. В группу риска инвазивной инфекции СГВ входят пожилые люди, люди с иммунодефицитным состоянием, злокачественными образованиями, сахарным диабетом и другими хроническими заболеваниями [2]. Среди клинических манифестаций СГВ инфекции у взрослых присутствуют поражения кожи, мягких тканей, инфекция мочевыводящих путей, бактериемия, пневмония, артрит и эндокардит [2, 3]. Наиболее опасными проявлениями инфекции, развивающимися у новорожденных, являются генерализованный сепсис, пневмония и менингит [4]. Стрептококки группы В являются одной из ведущих причин нео-натальной смертности [5]. Развитие резистентности к антибиотикам, таким как эритромицин и клиндамицин, у штаммов стрептококков указывает на необходимость создания системы эффективной профилактики инфекции [6—8]. На настоящий момент наиболее изучены и проведены через стадии клинических испытаний, включая испытания среди беременных женщин, стрептококковые вакцины на базе капсульного полисахарида СГВ и его конъюгатов с токсоидом столбняка и другими белками-носителями [9]. Однако вариабельность капсульного полисахарида довольно высока и лежит в основе серотипирования стрептококков группы В [10]. Разнообразие серологических вариантов капсулы СГВ не позволяет говорить об универсальности создаваемых полисахаридных вакцин.

Альтернативой традиционным подходам является разработка векторной вакцины против стрептококковой инфекции, с помощью которой можно осуществить доставку в клетки и экспрессию фрагментов генов консервативных поверхностных белков СГВ. Грамотный дизайн векторной вакцины позволит добиться комплексной стимуляции иммунного ответа, его широкой специфичности и обеспечения безопасности препарата. Рядом исследователей описано применение вируса гриппа в качестве векторной системы, обеспечивающей экспрессию участков генов респираторно-синцитиального вируса, вируса иммунодефицита человека и прочих патогенов в генах гемаг-глютинина (HA), нейраминидазы (NA) или NS1 [11—13]. Для стимуляции гуморального иммунного ответа встройку чужеродного генетического материала целесообразно производить в ген гемагглютинина вируса гриппа, представляющего собой поверхностный гликопротеин вириона и экспрессирующегося на поверхности инфицированных клеток. Молекула HA способна выдержать не только вставки малых чужеродных эпитопов в гипервариабельные антигенные сайты, но и достаточно больших полипептидов по N-концу молекулы [11, 14, 15]. В нашем исследовании в качестве векторной системы использовался холодоадаптированный вирус гриппа — штамм живой гриппозной вакцины (ЖГВ). Безопасность вакцины обес-печивается за счет ряда изменений во внутренних белках вируса (кодирующие мутации в генах полимеразного комплекса, матриксного белка, неструктурного белка), в результате которых вакцинный штамм обладает устойчивым температурочувствительным фенотипом. Гемагглютинин и нейраминидаза являются вариабельными компонентами вакцинных штаммов, их свойства не влияют на фенотип вируса и безопасность применения вакцины, что подтверждается опытом многолетнего использования препарата у людей [16—18]. Возможность использования холодоадаптированного штамма ЖГВ в качестве вектора уже была показана ранее [19].

ScaAB — поверхностный липопротеин стрептококков группы В, вовлеченный в транспорт ионов двухвалентных металлов. Данный белок также отвечает за адгезию и высококонсервативен среди стрептококков группы В, а также других видов патогенных стрептококков. Исследование иммунного ответа на экспериментальную инфекцию СГВ показало иммунодоминантность ScaAB в сравнении с другими поверхностными белками (Bac, С5а пептидаза). Указанный липопротеин также продемонстрировал высокую иммуногенность при иммунизации подопытных животных и наличие по крайней мере двух различных В-клеточных эпитопов, что в паре с высокой степенью консервативности гена scaAB среди всех штаммов СГВ делает его перспективным кандидатом для разработки антистрептококковой вакцины [20].

В связи с этим целью данной работы была разработка векторной вакцины на основе липопротеина ScaAB Streptococcus agalactiae и штамма холодоадаптированного вируса гриппа в качестве вектора.

Материал и методы

Конструирование химерных генов НА вируса гриппа, содержащих вставки из гена, кодирующего липопротеин ScaAB стрептококков группы В. Последовательность бактериальных генов встраивали между последовательностью, кодирующей сигнальный пептид и последовательностью НА1 субъединицы молекулы НА вируса гриппа. Для этого на начальном этапе в ген вирусного НА вносились сайты рестрикции для рестриктазы BsmBI между последовательностью сигнального пептида и НА1 субъединицы при помощи перекрывающейся (overlap) полимеразной цепной реакции (ПЦР). Для перекрывающейся ПЦР использовали разработанные праймеры Anhui-HA_BsmBI_F 5’ GAGACGGTACGTCTCCAGCAGACAAAATCTGCCTCG 3’, Anhui-HA_BsmBI_R 5’ GAGACGTACCGTCTCGCTGCTGCATTTGTTGGAATG 3’ и наборы Phusion Green Hot Start II High-Fidelity PCR Master Mix (Thermo Scientific, Cat. # F566S), Pfx50™ DNA Polymerase (Invitrogen, Cat. #12355−012). Далее конструкция встраивалась в вектор для обратной генетики вируса гриппа (pCIPolISapIT) по сайтам рестрикции SapI согласно методикам, описанным ранее [21]. Данный вектор содержит как промотор для РНК-полимеразы I типа, так и промотор для РНК-полимеразы II типа, которые располагаются по обе стороны от фрагмента-вставки. Таким образом, при попадании в чувствительную клетку происходят одновременно транскрипция и репликация рекомбинантного гена, что является достаточным для самосборки жизнеспособного вируса гриппа. Далее по сайтам рестрикции BsmBI в подготовленный на первом этапе вектор, уже несущий ген HA вируса гриппа, были клонированы гены, кодирующие различной длины кассеты белка ScaAB. Трансформация клеток E. coli химерным вектором проводилась с помощью коммерческого набора TransformAid Bacterial Transformation Kit (Thermo Scientific), после чего проводился отбор трансформированных искомой плазмидой колоний клеток. Для этого бактерии накапливали в жидкой среде с селективным антибиотиком (ампициллин), после чего из них выделялась плазмидная ДНК с помощью коммерческого набора GeneJET Plasmid Miniprep Kit (Thermo Scientific). Секвенирование клонированного фрагмента позволяло отобрать трансформированные бактерии, несущие плазмиду c нужной нам вставкой.

Сборка химерных вирусов гриппа, несущих бактериальные полипептиды. Для сборки жизнеспособных вирусных частиц плазмидные ДНК, кодирующие все гены вируса гриппа, накапливали в препаративных количествах, без эндотоксинов. Для этого использовали коммерческий набор реагентов GeneJET Endo Free Plasmid Maxiprep Kit (Thermo Scientific). Сборка химерных вирусов гриппа осуществлялась при помощи трансфекции клеток Vero (перевиваемая культура эпителия клеток почки африканской зеленой мартышки) набором из 8 плазмид, кодирующих все необходимые вирусные гены. Трансфекция проводилась путем электропорации с использованием системы трансфекции Neon Transfection System (Invitrogen), в режиме двух импульсов по 1150 вольт в течение 20 мс. Трансфецированные клетки инкубировали в бессывороточной среде OptiPRO (Gibco) в присутствии антибиотика-антимикотика и 5,0 мкг/мл трипсина при температуре 33 °C в атмосфере 5% СО2. На 3-и сутки инкубации клетки соскабливали с помощью скребка и ресуспендировали в среде, после чего полученной взвесью заражали развивающиеся куриные эмбрионы (РКЭ), по 200 мкл на эмбрион. РКЭ далее инкубировали при 33 °C в течение 48 ч.

Секвенирование генома химерных вирусов гриппа, несущих бактериальные полипептиды. Полногеномное секвенирование химерных вирусов гриппа осуществляли с использованием автоматического капиллярного секвенатора ABIPrism 3130xl (Applied Biosystems) и коммерческих наборов BigDye Terminator Cycle Sequencing Kit v3.1, согласно инструкциям производителя. Выделение вирусной РНК проводили при помощи набора MagJETтм Viral DNA and RNA Purification Kit (Thermo Scientific). Амплификацию генов перед секвенированием осуществляли одношаговым набором для ПЦР с обратной транскрипцией (ОТ-ПЦР) SuperScript III One-Step RT-PCR with Platinum Taq (Invitrogen), а выделение амплифицированных фрагментов из агарозного геля после электрофоретического разделения по длине — при помощи отечественных наборов для очистки ДНК из агарозного геля (Omnix).

Культивирование вирусов в развивающихся куриных эмбрионах. Культивирование использовавшихся в работе вирусов проводилось в аллантоисной полости 10-дневных развивающихся куриных эмбрионов (ООО «Племрепродуктор Назия», пос. Приладожский, Кировский район, Ленинградская обл.). РКЭ заражали в аллантоисную полость 200 мкл вируссодержащей жидкости и инкубировали при оптимальной (33 °С) температуре в течение 48 ч. Содержание вируса в хориоаллантоисной жидкости куриного эмбриона оценивали в реакции гемагглютинации с 1% куриными эритроцитами.

Для определения 50% эмбриональной инфекционной активности предварительно делали ряд 10-кратных падающих разведений исследуемого вирусного материала на фосфатно-солевом буфере (ФСБ), которыми впоследствии проводилось заражение из расчета 200 мкл на один РКЭ. После инкубации в течение 48 ч при температуре 33/38 °С или 6 сут при пониженной до 26 °C температуре 50% эмбриональную инфекционную дозу, выражаемую в lg ЭИД50/мл, рассчитывали по методу Рида и Менча [22].

Оценка ростовых характеристик вирусов гриппа в культуре клеток MDCK. Инфекционную активность вирусов определяли путем их титрования в 96-луночных планшетах, засеянных накануне клетками перевиваемой культуры клеток почки собаки MDCK (Madin-Darby canine kidney) в расчете 5·104 клеток на лунку. Перед заражением монослой клеток MDCK дважды отмывали стерильным раствором ФСБ, затем вносили в лунки подготовленные 10-кратные разведения вируса в объеме 25 мкл, по 4—6 лунок на разведение. После адсорбции вируса в течение 1 ч инокулят удаляли, после чего в каждую лунку вносили 150 мкл поддерживающей среды DMEM, содержащей 1 мкг/мл трипсина TPCK. Клетки инкубировали при оптимальной температуре 33 °C в атмосфере 5% СО2 в течение 3—4 сут. Наличие вируса в каждой лунке определяли в реакции гемагглютинации, инфекционный титр рассчитывали по методу Рида и Менча [22] и выражали в lg ТЦИД50/мл.

Для изучения кинетики репродукции вирусов лунки 6-луночных планшетов, покрытые однодневным монослоем клеток MDCK, в трех повторах заражали дозой вирусов 0,01 MOI (multiplicity of infection — количество инфекционных доз вируса в расчете на одну клетку), что соответствовало 4 lg ТЦИД50/0,5 мл. После адсорбции вируса в течение 1 ч инокулят удаляли, после чего планшеты отмывали ФСБ, в каждую лунку вносили 3 мл поддерживающей среды DMEM, содержащей 1 мкг/мл трипсина TPCK, и инкубировали при 33 °C в атмосфере 5% СО2. Пробы культуральной жидкости в объеме 130 мкл отбирали каждые 12 ч в течение 4 сут и хранили при –70 °С до их титрования в клетках MDCK по вышеописанному методу.

Оценка генетической стабильности вирусов при пассировании штаммов в РКЭ. Для оценки генетической стабильности вирусы прошли серию из 10 пассажей в РКЭ при температуре инкубации 33 °C, после чего вирусная РНК была выделена и секвенирована как описано выше.

Оценка экспрессии фрагментов scaAB в составе вектора. Оценка экспрессии фрагментов scaAB в составе вектора производилась методом Western Blot. Исследуемые вирусы очищали на градиенте сахарозы и содержание белка оценивали методом Брэдфорда. SDS-электрофорез вирусных белков (20 мкг/лунку) проводили в 12% полиакриламидном геле в вертикальной камере Mini-Protean Tetra («Bio-Rad», США) при 100 В в течение 1 ч. В качестве положительного контроля использовали рекомбинантный белок ScaAB в концентрации 5 мкг в лунку. SDS-электрофорез проводили в двух повторах, один из гелей окрашивали красителем QC Coomassie Stain («Bio-Rad», США), второй использовали для иммуноблотинга. Перенос белков на нитроцеллюлозную мембрану проводили в вертикальной камере при 250 мА в течение 1 ч. Детекцию ScaAB и его фрагментов в составе вектора осуществляли путем инкубации мембраны с раствором специфической антисыворотки мыши к белку ScaAB, после чего добавляли вторичные антитела, меченые пероксидазой хрена (Anti-Mouse IgG, «Sigma-Aldrich»). Проявление специ-фических бэндов осуществлялось с помощью тетраметилбензидина (TMB, «Sigma-Aldrich»).

Статистическая обработка данных. Статистическая обработка данных проводилась с помощью статистического пакета Statistica (версия 6,0) с использованием непараметрических критериев (рангового дисперсионного анализа Краскела—Уоллиса). Для представления полученных результатов использовали следующие показатели описательной статистики: среднегеометрические титры (СГТ); для данных, не подчиняющихся нормальному распределению, — медиана (Me) и квартили (Q1; Q3).

Результаты

Конструирование химерных вирусно-бактериальных генов методами генной инженерии и сборка вирусных частиц

Выбор фрагмента липопротеина ScaAB для встройки в молекулу НА вируса гриппа был произведен на основе анализа экспериментальных данных и результатов компьютерного моделирования. Были использованы данные об иммунодоминантных эпитопах молекул гомологичных металлотранспортеров из базы данных «Immune Epitope Data Base» (http://www.iedb.org), а также экспериментальные данные, полученные ранее в отделе молекулярной микробиологии ФГБНУ «ИЭМ», о роли разных участков ScaAB в индукции гуморального иммунного ответа. По результатам компьютерного моделирования были отобраны два наиболее перспективных варианта вставок фрагментов липопротеина ScaAB в молекулу HA вируса гриппа А, различающиеся по длине на 56 аминокислотных остатков (табл. 1).

Таблица 1. Варианты вставок участка липопротеина ScaAB в гемагглютинин вируса гриппа для получения векторной вакцины против стрептококковой инфекции Примечание. * — В-клеточные эпитопы, обнаруженные экспериментально в липопротеине ScaAB, охарактеризованные для гомолога ScaAB — липопротеина MtsA S. pyogenes [23].

Фрагменты гена scaAB, кодирующие интересующие участки белка, были встроены в ген гемагглютинина вируса гриппа A/Ануи/1/2013 (H7N9) между последовательностью, кодирующей сигнальный пептид, и началом последовательности HA1 субъединицы по схеме, приведенной на рис. 1, при

Рис. 1. Схема конструирования химерных генов НА вируса гриппа подтипа H7N9. SP: сигнальный пептид. HA1,2: субъединица 1,2 молекулы НА. BsmBI: сайт посадки рестриктазы BsmBI.
помощи «overlap» ПЦР и серии клонирований. Для присоединения был использован гибкий линкер, состоящий из семи аминокислот (AAAPGAA), наращенный по краям каждой из кассет вместе с сайтами рестрикции BsmBI путем 2-ступенчатой ПЦР. После внутриклеточного процессинга HA, включающего отщепление сигнального пептида, вставка антигенов стрептококка остается на N-конце вирусного гликопротеина. Данная последовательность линкера была выбрана из нескольких вариантов, согласно данным, полученным в экспериментальном исследовании [24].

Полученные гибридные гены встраивались в вектор для обратной генетики pCIPolISapIT, после чего последовательность вставки полностью секвенировали, чтобы исключить появление спонтанных мутаций в процессе клонирования генов.

Далее осуществлялась трансфекция клеток Vero набором плазмид, несущих все заданные вирусные гены (табл. 2),

Таблица 2. Состав генома ЖГВ A (H7N9) и рекомбинантных векторных вакцин Примечание. Ануи: А/Ануи/1/2013 (H7N9); Лен/17: А/Ленинград/134/17/57 (H2N2).
что позволяло получить жизнеспособные вирусы гриппа с химерным гемагглютинином [21].

Оба рекомбинантных штамма вируса гриппа, несущие в HA фрагменты бактериального липопротеина ScaAB длиной 85 и 141 аминокислот (а.к.), были успешно собраны.

Оценка биологических свойств экспериментальных векторных вакцин в системе РКЭ. По результатам оценки эффективности репродукции полученных экспериментальных векторных вакцин H7-ScaAB-85 и H7-ScaAB-141, а также исходного вакцинного вируса 17/H7N9 rg и донора аттенуации Лен/17, в РКЭ при различных температурах инкубации был охарактеризован их фенотип (рис. 2).

Рис. 2. Оценка фенотипических характеристик экспериментальных векторных вакцин в системе РКЭ. ca — холодоадаптированный фенотип; ts — температурочувствительный фенотип; ЭИД50 — 50% эмбриональная инфекционная доза.
Вирусы считали температурочувствительными (т.е. обладающими ts фенотипом), если их инфекционный титр при 38 °C был снижен по сравнению с 33 °C на ≥5,0 lg ЭИД50. Вирусы считали холодоадаптированными (т.е. обладающими са фенотипом), если их инфекционный титр при 26 °C был снижен по сравнению с 33 °C на ≤3,0 lg ЭИД50.

Вакцинный штамм 17/H7N9 rg и донор аттенуации Лен/17 обладали ts/ca фенотипами, т. е. плохо размножались при повышенной температуре 38 °C, при этом сохраняя способность активно реплицироваться при 26 °C (см. рис. 2). Однако вакцинные штаммы с химерными HA H7-ScaAB-85 и H7-ScaAB-141 обладали сниженным уровнем репродукции при 26 °C в сравнении с оптимальной температурой в среднем на 4 lg ЭИД50, т. е. не характеризовались свойством холодоадаптированности, обладая при этом температурочувствительным фенотипом.

Показатели инфекционной активности в РКЭ при температуре 33 °C для штаммов 17/H7N9 rg со вставками пептидов ScaAB и без таковых статистически значимо отличались: Kruskal—Wallis test: H (2, N=12)=6,42; p=0,0403. Вставка большей по размеру кассеты белка ScaAB (141 а.к.) значительно снижала инфекционную активность вируса при оптимальной температуре, тогда как вставка ScaAB-85 не оказывала такого влияния, вирус так же активно размножался в РКЭ при оптимальной температуре, как и контрольный вакцинный штамм 17/H7N9 rg.

Таким образом, штамм с химерным HA H7-ScaAB-85 обладал преимуществом в репродуктивной активности в РКЭ перед вирусом с большей по размеру вставкой чужеродного антигена в HA.

Оценка ростовых характеристик химерных вирусов гриппа в культуре клеток MDCK. Анализ ростовых характеристик рекомбинантных векторных вакцин в культуре клеток MDCK был проведен при оптимальных условиях инкубации (33 °С). Как и в случае с РКЭ, активность репродукции вируса H7-ScaAB-141 была значительно снижена по сравнению с контрольным штаммом 17/H7N9 rg и даже вирусом H7-ScaAB-85. Вставка в молекулу НА кассеты ScaAB размером 85 аминокислот не сказывалась на репродукции вируса в клетках млекопитающих (рис. 3).

Рис. 3. Инфекционная активность химерных вирусов гриппа в культуре клеток MDCK при оптимальной (33 °С) температуре инкубации и сроке инкубации 3 сут.

Результаты изучения кинетики репродукции рекомбинантных векторных вакцин в культуре клеток MDCK при множественности заражения MOI=0,01 представлены на рис. 4.

Рис. 4. Кинетика репродукции химерных вирусов гриппа в культуре клеток MDCK при дозе заражения MOI=0,01. Лимит детекции при определении ТЦИД50/мл=1,1 lg. Статистически значимые различия между 17/H7N9 rg и H7-ScaAB-141: * — p=0,027; статистически значимые различия между H7-ScaAB-85 и H7-ScaAB-141: ** — p=0,027; † — p=0,022; ‡, ζ — p=0,05.
Кривые динамики репродукции вируса H7-ScaAB-85 с химерным HA и контрольного вакцинного штамма 17/H7N9 rg не различаются статистически значимо. Штамм H7-ScaAB-141 с большей по размеру вставкой пептида ScaAB отставал по динамике накопления вирусных частиц в культуральной среде от штамма H7-ScaAB-85: статистически значимые различия в титрах были выявлены, начиная с 48 ч после заражения клеточного монослоя.

Таким образом, штамм с химерным HA H7-ScaAB-85 обладал преимуществом по ростовым характеристикам в культуре клеток MDCK перед вирусом с большей по размеру вставкой чужеродного антигена в HA.

Оценка генетической стабильности экспериментальных векторных вакцин. Генетическую стабильность экспериментальных векторных вакцин оценивали по результатам секвенирования гена HA после 5 и 10 пассажей штаммов H7-ScaAB-85 и H7-ScaAB-141 в РКЭ.

После 10 пассажей штамма H7-ScaAB-85 в РКЭ вставка фрагмента гена бактериального происхождения в ген HA вируса гриппа была сохранена без делеций/инсерций. Мутагенез в области химерного гена, кодирующей собственно поверхностный гликопротеин вируса гриппа, отсутствовал. Однако на третьем пассаже в позиции 161 вставки гена scaAB появилась минорная примесь C при доминирующем T. Это привело к появлению в 54-м положении из 85 аминокислот, представляющих вставку ScaAB СГВ, минорной примеси Ser, перешедшей в доминирующую а.к. за последующие 2 пассажа. Аминокислотная замена F54S сохранилась в химерном HA вплоть до 10-го пассажа (табл. 3).

Таблица 3. Генетическая стабильность векторной вакцины H7-ScaAB-85 при пассировании в РКЭ

На рис. 5 показаны

Рис. 5. Локализация аминокислотной замены F54S на модели пространственной структуры вставки на основе липопротеина ScaAB в молекулу НА. а — исходный вариант (F); б — пассажный вариант (S). Темным цветом выделены места расположения иммунодоминантных В-клеточных эпитопов, место расположения аминокислотной замены показано стрелкой.
модели исходного и пассажного вариантов фрагмента липопротеина ScaAB длиной 85 аминокислот, полученные с применением алгоритмов моделирования по гомологии [25]. В полученной модели аминокислотная замена располагается на линкерном участке, она не входит в состав экспериментальных В-клеточных эпитопов, которые, как видно из рис. 5, захватывают крупные альфа-спиральные участки.

Более крупная вставка бактериального происхождения в ген HA вируса гриппа претерпела серьезные мутационные изменения уже после первого пассажа штамма H7-ScaAB-141 в РКЭ, при этом была сохранена без делеций/инсерций вплоть до 10 пассажа. После первого пассажа среди 423 нуклеотидов вставки ScaAB было обнаружено 3 мутации (одна из которых кодирующая) и полиморфизм в 51 нуклеотидной позиции. При этом 2/3 полиморфизмов приходилось на первое и второе положение кодонов, т. е. с большой долей вероятности могло привести к аминокислотным заменам. В 94% случаев полиморфизм был вида T→C/T. Как и в случае со штаммом H7-ScaAB-85 мутагенез в области химерного гена, кодирующей непосредственно HA вируса гриппа, отсутствовал на протяжении всех 10 пассажей.

Таким образом, увеличение размера вставки чужеродного антигена в HA вируса гриппа с 85 до 141 а.к. влекло за собой серьезные нарушения генетической стабильности векторной вакцины.

Оценка экспрессии фрагментов scaAB в составе вектора. Экспрессию фрагмента бактериального происхождения размером 85 а.к. оценивали методом вестерн-блотт (рис. 6).

Рис. 6. Электрофорез в ПААГ (а) и иммуноблоттинг (б) химерной конструкции в составе штамма H7-ScaAB-85 с антисывороткой мыши к ScaAB. 1 — маркер молекулярного веса; 2 — H7; 3 — ScaAB; 4 — H7-ScaAB-85.
Из рисунка видно, что на нитроцеллюлозной мембране выявляются 2 полосы, специфичные бактериальному белку, с молекулярной массой ~60 и 80 кДа, что может соответствовать НА0 предшественнику гемагглютинина (более тяжелый белок) и НА1-субъединице НА, которая образуется в результате посттрансляционного расщепления молекулы НА0 на 2 субъединицы (НА1 и НА2). Поскольку вставка бактериального антигена расположена в НА1-субъединице, она распознается антителами к ScaAB белку и в отдельной НА1-субъединице, и в НА0 предшественнике.

Обсуждение

Вирусные векторы — перспективный путь адресной доставки и эффективной презентации интересующего антигена иммунной системе организма-реципиента. Допустимость и рациональность использования вируса в качестве вектора определяются по следующим критериям: безопасность; отсутствие предсуществующего и возможность преодоления вырабатываемого при вакцинации иммунитета к самому вирусному вектору, необходимые для эффективной выработки иммунного ответа на целевой антиген при первичной и повторной вакцинации; возможность производства вектора в больших масштабах и др.

В настоящий момент на различных стадиях апробации в качестве вирусных векторов находятся представители семейств Poxviridae, Adenoviridae, Togaviridae (альфавирусы), Picornaviridae (полиовирусы), Herpesviridae, Rhabdoviridae, Flaviviridae, Retroviridae, Parvoviridae, Paramyxoviridae. На ранних стадиях разработки векторной системы прежде всего решаются вопросы безопасности, исследуется потенциальная патогенность и онкогенность векторных систем [26, 27]. Так, рядом исследователей была показана онкогенность аденоассоциированных вирусов [28—30], до этого считавшихся безопасными в связи с апатогенностью для человека. Векторные системы, удовлетворяющие показателям безопасности, были созданы на основе поксвирусов и аденовирусов [27]. Среди существенных недостатков указанных вирусных векторов необходимо отметить предсуществующий иммунитет у населения по причине повсеместности вирусной инфекции или масштабных кампаний по вакцинации, а также высокую иммуногенность самих векторов, осложняющую ревакцинацию [26, 31, 32], даже в случае использования векторов на основе близкородственных вирусов животных [33].

Одно из решений проблемы предсуществующего коллективного иммунитета к антигенам вирусных векторов — использование векторов на основе вируса гриппа А. Вирус гриппа обладает высокой изменчивостью в области антигенных детерминант — гемагглютинина и нейраминидазы, с этим связана ежегодная высокая заболеваемость данной инфекцией в естественных условиях и необходимость ежегодного обновления состава вакцин. Для векторной системы это является преимуществом: отсутствие у прививаемого иммунного ответа на антигены вируса-вектора в составе вакцины обеспечивает возможность развития эффективного иммунного ответа на целевой антиген.

При использовании вируса гриппа в качестве векторной системы встройка чужеродной генетической информации может производиться в различные сегменты РНК вируса [11—13, 34]. Наиболее часто используются гемагглютинин, нейраминидаза и NS гены [11, 13]. Эффективной стимуляции клеточного звена иммунитета, что является важным в случае разработки противовирусных вакцин, позволяют достигнуть вставки в NS [13], а также в область ножки нейраминидазы [12]. Стимуляция гуморального иммунитета может быть достигнута через генетическую модификацию гемагглютинина: таким образом были получены экспериментальные вакцины, содержащие иммуногенные эпитопы ВИЧ [14], малярийного плазмодия [11], респираторно-синцитиального вируса [15]. В случае респираторно-синцитиального ви-руса иммунодоминантные эпитопы были присоединены к молекуле гемагглютинина через гибкий линкер. Введение данного препарата вызывало у мышей образование специфических антител к респираторно-синцитиальному вирусу [15].

В нашей работе в качестве вектора был использован холодоадаптированный штамм живой гриппозной вакцины подтипа A (H7N9). Безопасность холодоадаптированного штамма обеспечивается комплексом мутаций в генах, кодирующих внутренние белки вируса. Возможность генетических манипуляций с холодоадаптированным штаммом обеспечивает обратно-генетическая система, разработанная нами ранее [21]. При использовании холодоадаптированного вируса гриппа в качестве вектора бактериальный антиген будет доставляться путем интраназального введения препарата, как в случае с обычной ЖГВ, что обеспечит стимуляцию местного иммунитета и защиту от вирусной/бактериальной инфекции уже во входных воротах — верхних дыхательных путях. Кроме того, комбинированная вакцина упростит систему профилактики, что особенно актуально в случае перегруженного календаря детских прививок.

При создании проекта новой векторной вакцины мы опирались на успех получения экспериментальной рекомбинантной вакцины против РСВ-инфекции, подготовленной нами ранее. Генетический материал респираторно-синцитиального вируса (фрагмент F-гликопротеина) был успешно встроен в гемагглютинин холодоадаптированного донора аттенуации, не оказав влияния на жизнеспособность штамма вируса гриппа [19].

В качестве бактериального антигена был выбран липопротеин ScaAB, выделенный у Streptococcus agalactiae. ScaAB относится к семейству белков-металлотранспортеров LraI, его гомологами являются PsaA (S. pneumoniae), ScaA (S. gordonii), MtsA (S. pyogenes) и ряд других липопротеинов [17]. После иммунизации лабораторных животных препаратом на основе ScaAB у них вырабатывался протективный иммунитет к стрептококкам групп, А и В, а также пневмококкам [35].

Методами генной инженерии были сконструированы гибридные гены НА вируса гриппа А/Ануи/1/2013 (H7N9), несущие фрагменты последовательности гена липопротеина ScaAB СГВ различной длины. В исходной структуре металлотранспортера можно выделить несколько областей, начиная с N-концевого сигнального пептида, подвергающегося отщеплению по С-концевому LxAC мотиву при процессинге белка [36]. Данная область обладает низкой степенью сходства с гомологичными белками других стрептококков [17], поэтому ее исключение представляется несущественным для моделирования иммунного ответа. За сигнальным пептидом следуют N-концевой и С-концевой домены, соединенные крупной альфа-спиралью. Каждый из доменов имеет характерную для представителя семейства металлсвязывающих рецепторов организацию: 4-цепочечный бета-слой, окруженный 4 альфа-спиралями. Во вставке ScaAB из 141 аминокислоты сохранен полностью С-концевой домен, а также альфа-спираль, соединяющая 2 домена, кроме того, этот вариант кассеты содержал 2 из 3 экспериментально установленных В-клеточных эпитопа. В минимальной вставке (85 а.к.) сохранены лишь 2 экспериментально установленных В-клеточных эпитопа, локализованные в С-концевом домене ScaAB. Бактериальные полипептиды были присоединены к N-концу субъединицы НА1 молекулы НА через гибкий линкер (AAAPGAA), позволяющий чужеродному белку независимо укладываться в третичную структуру, тем самым максимально приближая пространственную конфигурацию вставки к нативному бактериальному белку.

Два полученных химерных вируса (H7-ScaAB-85 и H7-ScaAB-141) представляли собой реассортантные штаммы живой гриппозной вакцины подтипа, А (H7N9) с модифицированным гемагглютинином. Поскольку все внутренние и неструктурные белки вакцинных штаммов принадлежали холодоадаптированному донору аттенуации Лен/17, ожидалось, что исследуемые вирусы с химерным HA должны сохранить основные фенотипические признаки, свойственные донору аттенуации, такие как температурочувствительность (ts фенотип) и холодоадаптированность (са фенотип). Однако внедрение в HA вакцинного штамма 17/H7N9 rg чужеродных бактериальных антигенов вне зависимости от размера пептидной вставки привело к утере свойства холодоадаптированности. Более того, c увеличением размера вставки фрагмента бактериального липопротеина ScaAB в HA вируса гриппа инфекционная активность последнего в РКЭ существенно угнеталась даже при оптимальной температуре инкубации. С точки зрения безопасности вакцины основным требованием является свойство чувствительности к повышенной температуре, сохранившееся у обоих рекомбинантных штаммов. Потеря ca фенотипа снижает способность вируса реплицироваться при субоптимальной температуре, не влияя на характеристики безопасности будущей вакцины.

Результаты, полученные в культуре клеток MDCK, также позволяют сделать вывод о негативном влиянии на ростовые характеристики химерных вирусов гриппа чужеродных вставок больших размеров. Так, вставка фрагмента белка ScaAB длиной в 85 аминокислот никак не сказалась на инфекционной активности вируса гриппа в культуре клеток, тогда как вирус, экспрессирующий кассету из 141 аминокислоты рассматриваемого бактериального антигена, значительно уступал в активности репродукции исходному вакцинному штамму ЖГВ 17/H7N9 rg, использовавшемуся в качестве вирусного вектора, и химерному штамму H7-ScaAB-85 как по динамике накопления вирусных частиц в культуральной среде, так и по величине титра по истечении 3 сут инкубации.

Химерный HA штамма H7-ScaAB-85 продемонстрировал генетическую стабильность при 10-кратном пассировании в РКЭ как в области, кодирующей поверхностный гликопротеин вируса гриппа, так и в части гена, представляющей собой генетический материал СГВ. В процессе пассирования штамма была обнаружена только одна аминокислотная замена, приходящаяся на 54-ю позицию из 85 а.к. вставки бактериального липопротеина. По результатам компьютерного моделирования данная замена располагается на линкерном участке, соединяющем 2 экспериментально обнаруженных В-клеточных эпитопа, захватывающих крупные альфа-спирали, консервативные среди гомологичных бактериальных металлотранспортеров. Предположительно, замена в данном участке не должна принципиальным образом повлиять на иммуногенность вакцины. Модели, полученные по гомологии, не выявили значительных отличий в третичной структуре исходного варианта фрагмента ScaAB и пассажного варианта, содержащего аминокислотную замену. Специфичность и защитную эффективность антител, вырабатываемых при иммунизации полученной векторной вакциной, против СГВ с нативным антигеном ScaAB предстоит оценить в последующих экспериментах.

Увеличение размера вставки бактериального антигена в HA штамма 17/H7N9 rg до 141 а.к. сопровождалось интенсивным мутагенезом в области вставки ScaAB в химерный ген HA, уже с первых пассажей вируса в РКЭ. Отметим, что в результате мутационных изменений произошло существенное увеличение GC-состава вставки ScaAB (с 33 до 45%), однако не только за счет «молчащих», но и кодирующих мутаций, сильно повлиявших на первичную структуру белкового фрагмента. Указанный факт ставит под сомнение возможность использования рекомбинантного штамма вируса гриппа H7-ScaAB-141 в качестве векторной вакцины против СГВ, несмотря на то что с точки зрения стимуляции иммунного ответа к бактериальному патогену предпочтителен химерный вирус, несущий более длинные фрагменты липопротеина ScaAB в составе HA.

Заключение

По результатам анализа репродуктивной активности в РКЭ, культуре клеток MDCK, а также генетической стабильности, рекомбинантный штамм на базе холодоадаптированного вируса гриппа подтипа A (H7N9), включающий в состав поверхностного гликопротеина вставку из 85 аминокислот липопротеина ScaAB Streptococcus agalactiae, был отобран в качестве наиболее перспективного кандидата для дальнейших исследований защитной эффективности новой векторной вакцины на экспериментальной модели стрептококковой инфекции у мышей. Увеличение размера вставки чужеродного антигена в HA вируса гриппа влекло за собой нарушение генетической стабильности векторной вакцины с ухудшением всех ростовых характеристик в различных чувствительных системах.

Работа выполнялась в рамках гранта Президента Р.Ф. по государственной поддержке ведущих научных школ РФ №НШ-9646.2016.7.

Авторы заявляют об отсутствии конфликта интересов.

Настоящая статья не содержит каких-либо исследований с участием людей или животных в качестве объектов исследований.

Сведения об авторах:

Сведения об авторах

Смолоногина Татьяна Анатольевна [Smolonogina Tatiana] — к.б.н., с.н.с. отдела вирусологии им. А.А. Смородинцева ФГБНУ «Институт экспериментальной медицины»; e-mail: smolonogina@mail.ru

Исакова-cивак Ирина Николаевна [Isakova-Sivak Irina] — к.б.н., в.н.с. отдела вирусологии им. А.А. Смородинцева ФГБНУ «Институт экспериментальной медицины»; e-mail: isakova.sivak@gmail.com

Котомина Татьяна Сергеевна [Kotomina Tatiana] — н.с. отдела вирусологии им. А.А. Смородинцева ФГБНУ «Институт экспериментальной медицины»; e-mail: tstretiak@gmail.com

Евсина Анастасия Сергеевна [Evsina Anastasiia] — студент отдела вирусологии им. А.А. Смородинцева ФГБНУ «Институт экспериментальной медицины»; e-mail: anastasiia.evsina@gmail.com

Степанова Екатерина Алексеевна [Stepanova Ekaterina] — к.б.н., с.н.с. отдела вирусологии им. А.А. Смородинцева ФГБНУ «Институт экспериментальной медицины»; e-mail: fedorova.iem@gmail.com

Прокопенко Полина Игоревна [Prokopenko Polina] — студ., отдел вирусологии им. А.А. Смородинцева ФГБНУ «Институт экспериментальной медицины»; e-mail: prokkopenko@mail.ru

Леонтьева Галина Федоровна [Leontieva Galina] — к.б.н., в.н.с. отдела молекулярной микробиологии ФГБНУ «Институт экспериментальной медицины»; e-mail: galeonte@yandex.ru

Суворов Александр Николаевич [Suvorov Alexander] — член.-корр. РАН, проф., д.м.н., заведующий отделом молекулярной микробиологии ФГБНУ «Институт экспериментальной медицины»; e-mail: alexander_suvorov1@hotmail.com

Руденко Лариса Георгиевна [Rudenko Larisa] — д.м.н., проф., заведующий отделом вирусологии им. А.А. Смородинцева ФГБНУ «Институт экспериментальной медицины»; e-mail: vaccine@mail.ru

Для корреспонденции: Смолоногина Татьяна Анатольевна, канд. биол. наук, старший научный сотрудник отдела вирусологии им. А.А. Смородинцева ФГБНУ «Институт экспериментальной медицины», 197376, Санкт-Петербург, ул. акад. Павлова, д. 12; e-mail: smolonogina@mail.ru

Список литературы:

  1. De Amicis KM, Freschi de Barros S, Alencar RE, Postól E, Martins Cde O, Arcuri HA, et al. Analysis of the coverage capacity of the StreptInCor candidate vaccine against Streptococcus pyogenes. Vaccine. 2014;32(32):4104-4110.
  2. Edwards MS, Baker CJ. Group B Streptococcal infections in elderly adults. Clin Infect Dis. 2005;41:839-847.
  3. Farley MM. Group B Streptococcal disease in nonpregnant adults. Clin Infect Dis. 2001;33:556-561.
  4. Berardi A, Cattelani C, Creti R, Berner R, Pietrangiolillo Z, Margarit I, et al. Group B Streptococcal infections in the newborn infant and the potential value of maternal vaccination. Expert Rev Anti Infect Ther. 2015;13(11):1387-1399.
  5. Edmond KM, Kortsalioudaki C, Scott S, Schrag SJ, Zaidi AK, Cousens S, et al. Group B streptococcal disease in infants aged younger than 3 months: systematic review and meta-analysis. Lancet. 2012;379(9815):547-556.
  6. Simoes JA, Aroutcheva AA, Heimler I, Faro S. Antibiotic resistance patterns of Group B Streptococcal clinical isolates. Infect Dis Obstet Gynecol. 2004;12:1-8.
  7. Heelan JS, Hasenbein ME, McAdam AJ. Resistance of Group B Streptococcus to selected antibiotics, including erythromycin and clindamycin. J Clin Microbiol. 2004;42:1263-1264.
  8. Mousavi SM, Nasaj M, Hosseini SM, Arabestani MR. Survey of strain distribution and antibiotic resistance pattern of group B streptococci (Streptococcus agalactiae) isolated from clinical specimens. GMS Hyg Infect Control. 2016;11:Doc18. https://doi.org/10.3205/dgkh000278
  9. Heath PT. Status of vaccine research and development of vaccines for GBS. Vaccine. 2016;34(26):2876-2879.
  10. Cieslewicz MJ, Chaffin D, Glusman G, Kasper D, Madan A, Rodrigues S, et al. Structural and Genetic Diversity of Group B Streptococcus Capsular Polysaccharides. Infect Immun. 2005;73(5):3096-3103.
  11. Garcia-Sastre A, Palese P. Influenza virus vectors. Biologicals. 1995;23(2):171-178.
  12. De Baets S, Schepens B, Sedeyn K, Schotsaert M, Roose K, Bogaert P, et al. Recombinant influenza virus carrying the respiratory syncytial virus (RSV) F85-93 CTL epitope reduces RSV replication in mice. J Virol. 2013;87(6):3314-3323.
  13. Bian C, Liu S, Liu N, Zhang G, Xing L, Song Y, et al. Influenza virus vaccine expressing fusion and attachment protein epitopes of respiratory syncytial virus induces protective antibodies in BALB/c mice. Antiviral Res. 2014;104:110-117.
  14. Hatziioannou T, Delahaye E, Martin F, Russell SJ, Cosset FL. Retroviral display of functional binding domains fused to the amino terminus of influenza hemagglutinin. Hum Gene Ther. 1999;10(9):1533-1544.
  15. Lee YN, Hwang HS, Kim MC, Lee YT, Lee JS, Moore ML, et al. Recombinant influenza virus expressing a fusion protein neutralizing epitope of respiratory syncytial virus (RSV) confers protection without vaccine-enhanced RSV disease. Antiviral Res. 2015;115:1-8.
  16. Rudenko LG, Lonskaya NI, Klimov AI, Vasilieva RI, Ramirez A. Clinical and epidemiological evaluation of a live, cold-adapted influenza vaccine for 3—14-year-olds. Bull World Health Organ. 1996;74(1):77-84.
  17. Rudenko LG, Arden NH, Grigorieva E, Naychin A, Rekstin A, Klimov AI, et al. Immunogenicity and efficacy of Russian live attenuated and US inactivated influenza vaccines used alone and in combination in nursing home residents. Vaccine. 2000;19(2-3):308-318.
  18. Дорошенко Е.М., Григорьева Е.П. Безопасность, иммуногенность и эффективность живых гриппозных аттенуированных интраназальных вакцин — опыт многолетнего применения в различных возрастных группах. Эпидемиология и вакцинопрофилактика. 2013;4(71):67-73.
  19. Isakova-Sivak I, Tretiak T., Rudenko L. Cold-adapted influenza viruses as a promising platform for viral-vector vaccines. Expert Rev Vaccines. 2016;15(10):1241-1243.
  20. Vorobieva EI, Meringova LF, Leontieva GF, Grabovskaya KB, Suvorov AN. Analysis of recombinant group B streptococcal protein ScaAB and evaluation of its immunogenicity. Folia Microbiol (Praha). 2005;50(2):172-176.
  21. Isakova-Sivak I, Chen LM, Matsuoka Y, Voeten JT, Kiseleva I, Heldens JG, et al. Genetic bases of the temperature-sensitive phenotype of a master donor virus used in live attenuated influenza vaccines: A/Leningrad/134/17/57 (H2N2). Virology. 2011;412(2):297-305.
  22. Reed LJ, Muench H. A simple method of estimating fifty percent endpoints. The American Journal of Hygiene. 1938;27(3):493-497.
  23. McMillan DJ, Batzloff MR, Browning CL, Davies MR, Good MF, Sriprakash KS, et al. Identification and assessment of new vaccine candidates for group A streptococcal infections. Vaccine. 2004;22(21-22):2783-2790.
  24. Lee YN, Hwang HS, Kim MC, Lee YT, Cho MK, Kwon YM, et al. Recombinant influenza virus carrying the conserved domain of respiratory syncytial virus (RSV) G protein confers protection against RSV without inflammatory disease. Virology. 2015;476:217-225.
  25. Biasini M, Bienert S, Waterhouse A, Arnold K, Studer G, Schmidt T, et al. SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information. Nucleic Acids Research. 2014;42(W1):252-258.
  26. Souza AP, Haut L, Reyes-Sandoval A, Pinto AR. Recombinant viruses as vaccines against viral diseases. Braz J Med Biol Res. 2005;38(4):509-522.
  27. Ura T, Okuda K, Shimada M. Developments in viral vector-based vaccines. Vaccines. 2014;2(3):624-641.
  28. Donsante A, Miller DG, Li Y, Vogler C, Brunt EM, Russell DW, Sands MS. AAV vector integration sites in mouse hepatocellular carcinoma. Science. 2007;317(5837):477.
  29. Berns KI, Byrne BJ, Flotte TR, Gao G, Hauswirth WW, Herzog RW, et al. Adeno-associated virus type 2 and hepatocellular carcinoma? Human gene therapy. 2015;26(12):779-781.
  30. Russell DW, Grompe M. Adeno-associated virus finds its disease. Nature genetics. 2015;47(10):1104.
  31. Saxena M, Van TT, Baird FJ, Coloe PJ, Smooker PM. Pre-existing immunity against vaccine vectors — friend or foe? Microbiology. 2013;159:1-11.
  32. Sekaly RP. The failed HIV Merck vaccine study: a step back or a launching point for future vaccine development? Journal of Experimental Medicine. 2008;205(1):7-12.
  33. Rerks-Ngarm S, Pitisuttithum P, Nitayaphan S, Kaewkungwal J, Chiu J, Paris R, et al. Vaccination with ALVAC and AIDSVAX to prevent HIV-1 infection in Thailand. New England Journal of Medicine. 2009;361(23):2209-2220.
  34. Breen M, Nogales A, Baker SF, Martínez-Sobrido L. Replication-competent Influenza A viruses expressing reporter genes. Viruses. 2016;8(7):179.
  35. Суворов А.Н., Грабовская К.Б., Леонтьева Г.Ф., Мерингова Л.Ф., Королева И.Н., Дуплик Н.В. и др. Рекомбинантные фрагменты консервативных белков СГВ как основа специфической вакцины. ЖМЭИ. 2010;2:44-50.
  36. Jenkinson HF. Cell surface protein receptors in oral streptococci. FEMS Microbiol Lett. 1994;121(2):133-140.